dijous, de novembre 06, 2008

ADN de dinosaure?

S'ha mort en Michael Crichton, l’autor d’un grapat d’obres famoses, com ara “Rescat en el temps”, “Congo”, “Esfera”, “L’Amenaça d’Andròmeda” o la sèrie de televisió “Urgències”. Però la novel·la que segurament el va fer més famós va ser “Parc Juràssic” i que va donar lloc a la pel·lícula de l’Spielverg. I justament d'aquesta obra vaig sentir una anècdota ben curiosa.

Si recordeu, a la novel·la, els científics de InGen, liderats pel Dr. Henry Wu, aconseguien clonar dinosaures gràcies a l’ADN que obtenien de mosquits preservats en ambre. El mosquit tenia a l’estómac sang de dinosaure al que havia picat poc abans de quedar atrapat a la resina i els investigadors el recuperaven i clonaven.

Malgrat les dificultats tècniques, actualment encara insuperables, s’ha de reconèixer que la idea era bona. Faria falta molts calers, sobretot per poder seqüenciar ràpidament l’ADN que anessin obtenint, però segons la novel·la, els d’InGen disposaven de tres superordinadors Cray XMP i un grapat de seqüenciadors automàtics, de manera que la potència de treball assegurava que la feina es podia fer.

I en un dels moments de la novel·la, quan estan fent una visita al Parc Juràssic, els mostren als visitants una seqüència d’ADN de dinosaure. Un fragment que, en paraules del Dr. Wu “... ha de contenir les instruccions per fabricar una proteïna, diguem una hormona o un enzim”.

La seqüència en qüestió és:

>DinoDNA from JURASSIC PARK  p. 103 nt 1-1200
GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC
GGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG
TGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC
TGCTCACGCTGTACCTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTG
CCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAA
AGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAG
ATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACT
CCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCT
GGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGG
CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA
CGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGATCGTCACGGCGATTTATGCCG
CACATGGACGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAA
CAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAA
GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG
CTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTG
ACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCA
ACACGACTTAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCC
GCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGG
CCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGG
CCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCT 

Com veieu, es tracta d’una seqüència feta amb quatre lletres corresponents als quatre components de l’ADN. De fet, quan parlem del genoma humà o d'altres espècies, el que tenim és simplement una seqüència semblant però de molts milions de lletres de llargada. Fins aquí, el que va escriure en Crichton és correcte. Però l’anècdota relacionada amb aquest fragment és que un bon dia, un investigador es va preguntar si aquesta era una seqüència inventada a l’atzar per l’autor, o era una versió més realista i corresponia a una proteïna de pollastre modificada per deduir com seria feia 270 milions d’anys.

I el que va fer va ser el que en diem un BLAST, que bàsicament és introduir la seqüència a un ordinador i que aquest la compari amb les seqüències que ja coneixem de diferents organismes. Això ara es fa rutinàriament ja que actualment ja hi ha molts genomes clonats i d’altres en sabem la seqüència de moltíssims gens.

La decepció va ser que l’ordinador si que va trobar aquesta seqüència! I per descomptat no correspon a un gen de dinosaure. El que és exactament és un fragment d’ADN sintetitzat per científics i emprat per transportar altres gens. És com si diguéssim un gen transportador artificial. Exactament és el plàsmid pBR322.

El científic (real) que va buscar que era aquella seqüència va expressar la seva decepció de manera sarcàstica. No entenia com el Dr. Wu, tot i disposar de tres superordinadors Cray, no s’havia adonat que el que tenia devia ser una contaminació artificial de l’ADN de dinosaure. Una cosa que es pot verificar en un parell de minuts fent servir un ordinador portàtil normalet.

És clar, també podria ser que els dinosaures haguessin coexistit amb els primers biòlegs moleculars, però això sembla encara menys probable!

Tot plegat és anecdòtic, però ho va poder publicar l’any 92 a BioTechniques, una revista seriosa.

El cas és que quan li ho van comentar a en Michael Crichton va dir, de bon humor, el que era previsible. “Mai hauria pensat que algú es prendria la molèstia de mirar que coi era aquella seqüència!”.

Sembla que realment va subestimar la vena friki que tenim els científics.

7 comentaris :

nephew ha dit...

Sempre hi haurà algú que acabarà trobant la veritat de les coses, encara que desprès perdin el seu encant!

Laia ha dit...

Mmm... jo crec que si fos l'escriptor del llibre hagués començat a picar As, Ges, Tes i Ces aleatòriament fins que en tingués prous... si més no, hi hauria menys probabilitats de que la meva seqüència fos coneguda a vida real!!

Carquinyol ha dit...

Coses de tenir massa curiositat.... i massa temps lliure !! Però reconec que aquests detalls frikis m'encanten !!

Per cert, la 'G' darrera de la 53a 'A' no sé jo si és correcta del tot :P :P :P

Anna ha dit...

no acabo de tenir clar que és més erroni, perquè picar lletres a l'atzar conduiria a seqüències sense sentit que no es podrien transcriure perquè els faltarien els elements resguladors. Segurament, el millor hauria estat, com diu l'article, modificar una proteïna de pollastre. Realment... que friki tot plegat! :D

Alasanid ha dit...

Llàstima que el 92 els Ig Nobel no tinguessin el prestigi que tenen ara que si no...

De totes maneres va buscar alguna cosa i això ja és tot un detall.

La veritat és que d'aquest home només n'he vist la versió de l'Spilverg.

Vallve ha dit...

Aquesta història em sona. La segona part tampoc té desperdici, la podeu trobar a http://vallve.blogspot.com/2008/09/dna-despcies-extingides.html

bajoqueta ha dit...

jajaja quina poca feina mirar això. Però molt curiós :)